write a literature review in 2 days

Have a language expert improve your writing

Run a free plagiarism check in 10 minutes, generate accurate citations for free.

• Knowledge Base

Methodology

• How to Write a Literature Review | Guide, Examples, & Templates

How to Write a Literature Review | Guide, Examples, & Templates

Published on January 2, 2023 by Shona McCombes . Revised on September 11, 2023.

What is a literature review? A literature review is a survey of scholarly sources on a specific topic. It provides an overview of current knowledge, allowing you to identify relevant theories, methods, and gaps in the existing research that you can later apply to your paper, thesis, or dissertation topic .

There are five key steps to writing a literature review:

• Search for relevant literature
• Evaluate sources
• Identify themes, debates, and gaps
• Outline the structure
• Write your literature review

A good literature review doesn’t just summarize sources—it analyzes, synthesizes , and critically evaluates to give a clear picture of the state of knowledge on the subject.

Instantly correct all language mistakes in your text

Upload your document to correct all your mistakes in minutes

Table of contents

What is the purpose of a literature review, examples of literature reviews, step 1 – search for relevant literature, step 2 – evaluate and select sources, step 3 – identify themes, debates, and gaps, step 4 – outline your literature review’s structure, step 5 – write your literature review, free lecture slides, other interesting articles, frequently asked questions, introduction.

• Quick Run-through
• Step 1 & 2

When you write a thesis , dissertation , or research paper , you will likely have to conduct a literature review to situate your research within existing knowledge. The literature review gives you a chance to:

• Demonstrate your familiarity with the topic and its scholarly context
• Develop a theoretical framework and methodology for your research
• Position your work in relation to other researchers and theorists
• Show how your research addresses a gap or contributes to a debate
• Evaluate the current state of research and demonstrate your knowledge of the scholarly debates around your topic.

Writing literature reviews is a particularly important skill if you want to apply for graduate school or pursue a career in research. We’ve written a step-by-step guide that you can follow below.

Receive feedback on language, structure, and formatting

Professional editors proofread and edit your paper by focusing on:

• Academic style
• Vague sentences
• Style consistency

See an example

Writing literature reviews can be quite challenging! A good starting point could be to look at some examples, depending on what kind of literature review you’d like to write.

• Example literature review #1: “Why Do People Migrate? A Review of the Theoretical Literature” ( Theoretical literature review about the development of economic migration theory from the 1950s to today.)
• Example literature review #2: “Literature review as a research methodology: An overview and guidelines” ( Methodological literature review about interdisciplinary knowledge acquisition and production.)
• Example literature review #3: “The Use of Technology in English Language Learning: A Literature Review” ( Thematic literature review about the effects of technology on language acquisition.)
• Example literature review #4: “Learners’ Listening Comprehension Difficulties in English Language Learning: A Literature Review” ( Chronological literature review about how the concept of listening skills has changed over time.)

You can also check out our templates with literature review examples and sample outlines at the links below.

Download Word doc Download Google doc

Before you begin searching for literature, you need a clearly defined topic .

If you are writing the literature review section of a dissertation or research paper, you will search for literature related to your research problem and questions .

Make a list of keywords

Start by creating a list of keywords related to your research question. Include each of the key concepts or variables you’re interested in, and list any synonyms and related terms. You can add to this list as you discover new keywords in the process of your literature search.

• Social media, Facebook, Instagram, Twitter, Snapchat, TikTok
• Body image, self-perception, self-esteem, mental health
• Generation Z, teenagers, adolescents, youth

Search for relevant sources

Use your keywords to begin searching for sources. Some useful databases to search for journals and articles include:

• Your university’s library catalogue
• Google Scholar
• Project Muse (humanities and social sciences)
• Medline (life sciences and biomedicine)
• EconLit (economics)
• Inspec (physics, engineering and computer science)

You can also use boolean operators to help narrow down your search.

Make sure to read the abstract to find out whether an article is relevant to your question. When you find a useful book or article, you can check the bibliography to find other relevant sources.

You likely won’t be able to read absolutely everything that has been written on your topic, so it will be necessary to evaluate which sources are most relevant to your research question.

For each publication, ask yourself:

• What question or problem is the author addressing?
• What are the key concepts and how are they defined?
• What are the key theories, models, and methods?
• Does the research use established frameworks or take an innovative approach?
• What are the results and conclusions of the study?
• How does the publication relate to other literature in the field? Does it confirm, add to, or challenge established knowledge?
• What are the strengths and weaknesses of the research?

Make sure the sources you use are credible , and make sure you read any landmark studies and major theories in your field of research.

You can use our template to summarize and evaluate sources you’re thinking about using. Click on either button below to download.

Take notes and cite your sources

As you read, you should also begin the writing process. Take notes that you can later incorporate into the text of your literature review.

It is important to keep track of your sources with citations to avoid plagiarism . It can be helpful to make an annotated bibliography , where you compile full citation information and write a paragraph of summary and analysis for each source. This helps you remember what you read and saves time later in the process.

Prevent plagiarism. Run a free check.

To begin organizing your literature review’s argument and structure, be sure you understand the connections and relationships between the sources you’ve read. Based on your reading and notes, you can look for:

• Trends and patterns (in theory, method or results): do certain approaches become more or less popular over time?
• Themes: what questions or concepts recur across the literature?
• Debates, conflicts and contradictions: where do sources disagree?
• Pivotal publications: are there any influential theories or studies that changed the direction of the field?
• Gaps: what is missing from the literature? Are there weaknesses that need to be addressed?

This step will help you work out the structure of your literature review and (if applicable) show how your own research will contribute to existing knowledge.

• Most research has focused on young women.
• There is an increasing interest in the visual aspects of social media.
• But there is still a lack of robust research on highly visual platforms like Instagram and Snapchat—this is a gap that you could address in your own research.

There are various approaches to organizing the body of a literature review. Depending on the length of your literature review, you can combine several of these strategies (for example, your overall structure might be thematic, but each theme is discussed chronologically).

Chronological

The simplest approach is to trace the development of the topic over time. However, if you choose this strategy, be careful to avoid simply listing and summarizing sources in order.

Try to analyze patterns, turning points and key debates that have shaped the direction of the field. Give your interpretation of how and why certain developments occurred.

If you have found some recurring central themes, you can organize your literature review into subsections that address different aspects of the topic.

For example, if you are reviewing literature about inequalities in migrant health outcomes, key themes might include healthcare policy, language barriers, cultural attitudes, legal status, and economic access.

Methodological

If you draw your sources from different disciplines or fields that use a variety of research methods , you might want to compare the results and conclusions that emerge from different approaches. For example:

• Look at what results have emerged in qualitative versus quantitative research
• Discuss how the topic has been approached by empirical versus theoretical scholarship
• Divide the literature into sociological, historical, and cultural sources

Theoretical

A literature review is often the foundation for a theoretical framework . You can use it to discuss various theories, models, and definitions of key concepts.

You might argue for the relevance of a specific theoretical approach, or combine various theoretical concepts to create a framework for your research.

Like any other academic text , your literature review should have an introduction , a main body, and a conclusion . What you include in each depends on the objective of your literature review.

The introduction should clearly establish the focus and purpose of the literature review.

Depending on the length of your literature review, you might want to divide the body into subsections. You can use a subheading for each theme, time period, or methodological approach.

As you write, you can follow these tips:

• Summarize and synthesize: give an overview of the main points of each source and combine them into a coherent whole
• Analyze and interpret: don’t just paraphrase other researchers — add your own interpretations where possible, discussing the significance of findings in relation to the literature as a whole
• Critically evaluate: mention the strengths and weaknesses of your sources
• Write in well-structured paragraphs: use transition words and topic sentences to draw connections, comparisons and contrasts

In the conclusion, you should summarize the key findings you have taken from the literature and emphasize their significance.

When you’ve finished writing and revising your literature review, don’t forget to proofread thoroughly before submitting. Not a language expert? Check out Scribbr’s professional proofreading services !

This article has been adapted into lecture slides that you can use to teach your students about writing a literature review.

Scribbr slides are free to use, customize, and distribute for educational purposes.

Open Google Slides Download PowerPoint

If you want to know more about the research process , methodology , research bias , or statistics , make sure to check out some of our other articles with explanations and examples.

• Sampling methods
• Simple random sampling
• Stratified sampling
• Cluster sampling
• Likert scales
• Reproducibility

 Statistics

• Null hypothesis
• Statistical power
• Probability distribution
• Effect size
• Poisson distribution

Research bias

• Optimism bias
• Cognitive bias
• Implicit bias
• Hawthorne effect
• Anchoring bias
• Explicit bias

A literature review is a survey of scholarly sources (such as books, journal articles, and theses) related to a specific topic or research question .

It is often written as part of a thesis, dissertation , or research paper , in order to situate your work in relation to existing knowledge.

There are several reasons to conduct a literature review at the beginning of a research project:

• To familiarize yourself with the current state of knowledge on your topic
• To ensure that you’re not just repeating what others have already done
• To identify gaps in knowledge and unresolved problems that your research can address
• To develop your theoretical framework and methodology
• To provide an overview of the key findings and debates on the topic

Writing the literature review shows your reader how your work relates to existing research and what new insights it will contribute.

The literature review usually comes near the beginning of your thesis or dissertation . After the introduction , it grounds your research in a scholarly field and leads directly to your theoretical framework or methodology .

A literature review is a survey of credible sources on a topic, often used in dissertations , theses, and research papers . Literature reviews give an overview of knowledge on a subject, helping you identify relevant theories and methods, as well as gaps in existing research. Literature reviews are set up similarly to other  academic texts , with an introduction , a main body, and a conclusion .

An  annotated bibliography is a list of  source references that has a short description (called an annotation ) for each of the sources. It is often assigned as part of the research process for a  paper .  

Cite this Scribbr article

If you want to cite this source, you can copy and paste the citation or click the “Cite this Scribbr article” button to automatically add the citation to our free Citation Generator.

McCombes, S. (2023, September 11). How to Write a Literature Review | Guide, Examples, & Templates. Scribbr. Retrieved June 18, 2024, from https://www.scribbr.com/dissertation/literature-review/

Is this article helpful?

Shona McCombes

Other students also liked, what is a theoretical framework | guide to organizing, what is a research methodology | steps & tips, how to write a research proposal | examples & templates, "i thought ai proofreading was useless but..".

I've been using Scribbr for years now and I know it's a service that won't disappoint. It does a good job spotting mistakes”

Write a Literature Review in a Day: Yes, It’s Possible, and It’s Actually Fun

Literature reviews: they are every writer’s least favorite part of writing.

Still, they are a fundamental aspect of scholarly work. They prove that a writer has scoured previous research on a topic, evaluated it, and demonstrated why their own research has merit.

After writing enough of these in grad school, I’ve decided to create a guide to help writers answer the question of “how to write a literature review in a day.”

I’ve also gathered helpful info from other academic and educational sources to further inspire.

After reading this article, you will know how to:

• Find the right, relevant literature.
• Properly organize and catalog works you gather.
• Develop a pattern out of and find gaps in accumulated research.
• Write a stellar review.

Now let’s get down to it.

First Things First: What Is a Literature Review?

A literature review proves that an individual is aware of what other researchers, or “giants” in their field have said on the subject.

As such, lit reviews will consist of literature from other researchers discussing a chosen topic. This literature can come from books, articles, reports, or websites.

As this YouTube video proclaims, academic writing involves “ standing on the shoulders of giants .”

But a lit review will not just be a list of academic references. That can fall into plagiarism territory, which you can learn about in this article .

Okay, but What Is Its Purpose?

Basically, they help you prove your point. That’s why I see them as jigsaw puzzles whose pieces are scattered across other scholarly work.

When you are scanning through other works, you are looking for those jigsaw pieces or patterns and gaps in prior research that you will address. When you finish writing, your puzzle will represent what other researchers have missed.

Structure of a Literature Review

Fortunately, they follow the typical format of intro-body-conclusion .

The intro of a lit review will introduce the paper’s topic and the key concepts the writer will explore.

The body is where all the jigsaw puzzles will be addressed, including:

• What have other researchers said about this topic?
• What is your interpretation of their findings?
• How does the prior research add to the topic’s significance?
• Is there a pattern? Or is there a gaping hole in the research?

And the conclusion will wrap up your arguments.

5 Steps to Write a Literature Review in a Day

1. Find the Relevant Literature

Estimated time: 1 hour

First up is finding a few relevant texts.

My favorite databases are Google Scholar, my library’s database, JSTOR, and Scorpus.

It’s important to distinguish formal vs. informal works, which you can read about here .

I consider effective keywords when searching for sources. These will be words similar to my topic.

2. Read SMARTLY

Estimated time: 1-2 hours

Yes, you’ll need to read, but the trick is to read smartly .

When you type in your keywords and are brought to an article, skim through the abstract and look for:

• The key concepts
• The overall findings
• The gap in the research (or the jigsaw pieces)

This will cut down your reading time tremendously!

In this video, the researcher shares a tough truth: “You HAVE to do reading.”

Some people are very restless and it can be difficult for them to focus. Reading smartly can reduce the time you spent studying.

3. Organize Your Findings

Estimated time: 1-2 hours (combined with step 2)

New Zealand ecologist and researcher Francis J. Burdon claims that a “ poorly executed ” lit review is one that has no “ adequate guidance .” Your material has no worth if not organized!

Often PhD candidates will begin their thesis with a literature review, but this can be poorly executed without adequate guidance. A new guide @MethodsEcolEvol looks to be a very useful resource providing a roadmap for scientists at all career stages https://t.co/k1yjQEF9td — Francis J. Burdon (@frank_burdon) July 1, 2021

While you’re going through articles, pull up either a Microsoft Excel or Google Sheets document to log all of your findings. Include the author and title for all works.

Another good tip is to add additional columns that categorize the findings by relevant keyword, methodology used, and key concept.

The last column for the organized sheet is the “main argument” of the article. Here, summarize the article’s findings in a few sentences.

4. Synthesize!

Estimated time: 2 hours

Now here comes the fun part (at least, to me!). It’s time to synthesize , a fancy word for putting those jigsaw pieces together.

Look over the main arguments and search for any common themes, patterns, contradictions, and weaknesses.

To help you settle on a structure from your findings, literature reviews are usually structured in the following ways:

Chronologically: These are written from when the research began to where it is now.

Thematic: These are organized by common sub themes found in research.

Methodological: These are structured by different academic frameworks used, including different styles of research (i.e., quantitative vs. qualitative).

In this YouTube video the online writing professor, David Taylor, makes a comforting point: “The answers are already out there.”

Everything you need is already written; your job is to put it all together.

5. Write It!

Estimated time: 3+ hours (depending on experience)

All you need to do now is write! I find that crafting a brief outline of which author I’ll mention first and then next helps me start.

In addition, Amina Yonis, a PhD graduate at University of College London, lays out a good format to remember when writing your lit review: background, narrower categories, focus and then hypothesis.

First release of the week! Here is a snippet of how to write a literature review from my new course lauching next week. I go through the precise lit review structure, a topic that students notoriously struggle with when writing. Watch – RT – Save https://t.co/GgdR3CODWm pic.twitter.com/UBl90GE9D2 — Amina Yonis (@DrAminaYonis) November 1, 2020

Useful Resources

• How to write a movie review
• Literature review vs. annotated bibliography vs. research paper… What’s the difference?
• American literature & culture: American literature
• List of academic databases and search engines

It’s not so bad, is it?

See? Writing a literature review doesn’t have to be a scary task!

The only other thing to keep in mind with lit reviews is plagiarism, as you will be referencing many other authors’ work.

Don’t worry, though — you can use this handy plagiarism tool here to make sure your content is 100% original.

Take these steps into account pre-writing and you’ll have a stellar review!

How To Write An A-Grade Literature Review

3 straightforward steps (with examples) + free template.

By: Derek Jansen (MBA) | Expert Reviewed By: Dr. Eunice Rautenbach | October 2019

Quality research is about building onto the existing work of others , “standing on the shoulders of giants”, as Newton put it. The literature review chapter of your dissertation, thesis or research project is where you synthesise this prior work and lay the theoretical foundation for your own research.

Long story short, this chapter is a pretty big deal, which is why you want to make sure you get it right . In this post, I’ll show you exactly how to write a literature review in three straightforward steps, so you can conquer this vital chapter (the smart way).

Overview: The Literature Review Process

• Understanding the “ why “
• Finding the relevant literature
• Cataloguing and synthesising the information
• Outlining & writing up your literature review
• Example of a literature review

But first, the “why”…

Before we unpack how to write the literature review chapter, we’ve got to look at the why . To put it bluntly, if you don’t understand the function and purpose of the literature review process, there’s no way you can pull it off well. So, what exactly is the purpose of the literature review?

Well, there are (at least) four core functions:

• For you to gain an understanding (and demonstrate this understanding) of where the research is at currently, what the key arguments and disagreements are.
• For you to identify the gap(s) in the literature and then use this as justification for your own research topic.
• To help you build a conceptual framework for empirical testing (if applicable to your research topic).
• To inform your methodological choices and help you source tried and tested questionnaires (for interviews ) and measurement instruments (for surveys ).

Most students understand the first point but don’t give any thought to the rest. To get the most from the literature review process, you must keep all four points front of mind as you review the literature (more on this shortly), or you’ll land up with a wonky foundation.

Okay – with the why out the way, let’s move on to the how . As mentioned above, writing your literature review is a process, which I’ll break down into three steps:

• Finding the most suitable literature
• Understanding , distilling and organising the literature
• Planning and writing up your literature review chapter

Importantly, you must complete steps one and two before you start writing up your chapter. I know it’s very tempting, but don’t try to kill two birds with one stone and write as you read. You’ll invariably end up wasting huge amounts of time re-writing and re-shaping, or you’ll just land up with a disjointed, hard-to-digest mess . Instead, you need to read first and distil the information, then plan and execute the writing.

Step 1: Find the relevant literature

Naturally, the first step in the literature review journey is to hunt down the existing research that’s relevant to your topic. While you probably already have a decent base of this from your research proposal , you need to expand on this substantially in the dissertation or thesis itself.

Essentially, you need to be looking for any existing literature that potentially helps you answer your research question (or develop it, if that’s not yet pinned down). There are numerous ways to find relevant literature, but I’ll cover my top four tactics here. I’d suggest combining all four methods to ensure that nothing slips past you:

Method 1 – Google Scholar Scrubbing

Google’s academic search engine, Google Scholar , is a great starting point as it provides a good high-level view of the relevant journal articles for whatever keyword you throw at it. Most valuably, it tells you how many times each article has been cited, which gives you an idea of how credible (or at least, popular) it is. Some articles will be free to access, while others will require an account, which brings us to the next method.

Method 2 – University Database Scrounging

Generally, universities provide students with access to an online library, which provides access to many (but not all) of the major journals.

So, if you find an article using Google Scholar that requires paid access (which is quite likely), search for that article in your university’s database – if it’s listed there, you’ll have access. Note that, generally, the search engine capabilities of these databases are poor, so make sure you search for the exact article name, or you might not find it.

Method 3 – Journal Article Snowballing

At the end of every academic journal article, you’ll find a list of references. As with any academic writing, these references are the building blocks of the article, so if the article is relevant to your topic, there’s a good chance a portion of the referenced works will be too. Do a quick scan of the titles and see what seems relevant, then search for the relevant ones in your university’s database.

Method 4 – Dissertation Scavenging

Similar to Method 3 above, you can leverage other students’ dissertations. All you have to do is skim through literature review chapters of existing dissertations related to your topic and you’ll find a gold mine of potential literature. Usually, your university will provide you with access to previous students’ dissertations, but you can also find a much larger selection in the following databases:

• Open Access Theses & Dissertations
• Stanford SearchWorks

Keep in mind that dissertations and theses are not as academically sound as published, peer-reviewed journal articles (because they’re written by students, not professionals), so be sure to check the credibility of any sources you find using this method. You can do this by assessing the citation count of any given article in Google Scholar. If you need help with assessing the credibility of any article, or with finding relevant research in general, you can chat with one of our Research Specialists .

Alright – with a good base of literature firmly under your belt, it’s time to move onto the next step.

Need a helping hand?

Step 2: Log, catalogue and synthesise

Once you’ve built a little treasure trove of articles, it’s time to get reading and start digesting the information – what does it all mean?

While I present steps one and two (hunting and digesting) as sequential, in reality, it’s more of a back-and-forth tango – you’ll read a little , then have an idea, spot a new citation, or a new potential variable, and then go back to searching for articles. This is perfectly natural – through the reading process, your thoughts will develop , new avenues might crop up, and directional adjustments might arise. This is, after all, one of the main purposes of the literature review process (i.e. to familiarise yourself with the current state of research in your field).

As you’re working through your treasure chest, it’s essential that you simultaneously start organising the information. There are three aspects to this:

• Logging reference information
• Building an organised catalogue
• Distilling and synthesising the information

I’ll discuss each of these below:

2.1 – Log the reference information

As you read each article, you should add it to your reference management software. I usually recommend Mendeley for this purpose (see the Mendeley 101 video below), but you can use whichever software you’re comfortable with. Most importantly, make sure you load EVERY article you read into your reference manager, even if it doesn’t seem very relevant at the time.

2.2 – Build an organised catalogue

In the beginning, you might feel confident that you can remember who said what, where, and what their main arguments were. Trust me, you won’t. If you do a thorough review of the relevant literature (as you must!), you’re going to read many, many articles, and it’s simply impossible to remember who said what, when, and in what context . Also, without the bird’s eye view that a catalogue provides, you’ll miss connections between various articles, and have no view of how the research developed over time. Simply put, it’s essential to build your own catalogue of the literature.

I would suggest using Excel to build your catalogue, as it allows you to run filters, colour code and sort – all very useful when your list grows large (which it will). How you lay your spreadsheet out is up to you, but I’d suggest you have the following columns (at minimum):

• Author, date, title – Start with three columns containing this core information. This will make it easy for you to search for titles with certain words, order research by date, or group by author.
• Categories or keywords – You can either create multiple columns, one for each category/theme and then tick the relevant categories, or you can have one column with keywords.
• Key arguments/points – Use this column to succinctly convey the essence of the article, the key arguments and implications thereof for your research.
• Context – Note the socioeconomic context in which the research was undertaken. For example, US-based, respondents aged 25-35, lower- income, etc. This will be useful for making an argument about gaps in the research.
• Methodology – Note which methodology was used and why. Also, note any issues you feel arise due to the methodology. Again, you can use this to make an argument about gaps in the research.
• Quotations – Note down any quoteworthy lines you feel might be useful later.
• Notes – Make notes about anything not already covered. For example, linkages to or disagreements with other theories, questions raised but unanswered, shortcomings or limitations, and so forth.

If you’d like, you can try out our free catalog template here (see screenshot below).

2.3 – Digest and synthesise

Most importantly, as you work through the literature and build your catalogue, you need to synthesise all the information in your own mind – how does it all fit together? Look for links between the various articles and try to develop a bigger picture view of the state of the research. Some important questions to ask yourself are:

• What answers does the existing research provide to my own research questions ?
• Which points do the researchers agree (and disagree) on?
• How has the research developed over time?
• Where do the gaps in the current research lie?

To help you develop a big-picture view and synthesise all the information, you might find mind mapping software such as Freemind useful. Alternatively, if you’re a fan of physical note-taking, investing in a large whiteboard might work for you.

Step 3: Outline and write it up!

Once you’re satisfied that you have digested and distilled all the relevant literature in your mind, it’s time to put pen to paper (or rather, fingers to keyboard). There are two steps here – outlining and writing:

3.1 – Draw up your outline

Having spent so much time reading, it might be tempting to just start writing up without a clear structure in mind. However, it’s critically important to decide on your structure and develop a detailed outline before you write anything. Your literature review chapter needs to present a clear, logical and an easy to follow narrative – and that requires some planning. Don’t try to wing it!

Naturally, you won’t always follow the plan to the letter, but without a detailed outline, you’re more than likely going to end up with a disjointed pile of waffle , and then you’re going to spend a far greater amount of time re-writing, hacking and patching. The adage, “measure twice, cut once” is very suitable here.

In terms of structure, the first decision you’ll have to make is whether you’ll lay out your review thematically (into themes) or chronologically (by date/period). The right choice depends on your topic, research objectives and research questions, which we discuss in this article .

Once that’s decided, you need to draw up an outline of your entire chapter in bullet point format. Try to get as detailed as possible, so that you know exactly what you’ll cover where, how each section will connect to the next, and how your entire argument will develop throughout the chapter. Also, at this stage, it’s a good idea to allocate rough word count limits for each section, so that you can identify word count problems before you’ve spent weeks or months writing!

PS – check out our free literature review chapter template…

3.2 – Get writing

With a detailed outline at your side, it’s time to start writing up (finally!). At this stage, it’s common to feel a bit of writer’s block and find yourself procrastinating under the pressure of finally having to put something on paper. To help with this, remember that the objective of the first draft is not perfection – it’s simply to get your thoughts out of your head and onto paper, after which you can refine them. The structure might change a little, the word count allocations might shift and shuffle, and you might add or remove a section – that’s all okay. Don’t worry about all this on your first draft – just get your thoughts down on paper.

Once you’ve got a full first draft (however rough it may be), step away from it for a day or two (longer if you can) and then come back at it with fresh eyes. Pay particular attention to the flow and narrative – does it fall fit together and flow from one section to another smoothly? Now’s the time to try to improve the linkage from each section to the next, tighten up the writing to be more concise, trim down word count and sand it down into a more digestible read.

Once you’ve done that, give your writing to a friend or colleague who is not a subject matter expert and ask them if they understand the overall discussion. The best way to assess this is to ask them to explain the chapter back to you. This technique will give you a strong indication of which points were clearly communicated and which weren’t. If you’re working with Grad Coach, this is a good time to have your Research Specialist review your chapter.

Finally, tighten it up and send it off to your supervisor for comment. Some might argue that you should be sending your work to your supervisor sooner than this (indeed your university might formally require this), but in my experience, supervisors are extremely short on time (and often patience), so, the more refined your chapter is, the less time they’ll waste on addressing basic issues (which you know about already) and the more time they’ll spend on valuable feedback that will increase your mark-earning potential.

Literature Review Example

In the video below, we unpack an actual literature review so that you can see how all the core components come together in reality.

Let’s Recap

In this post, we’ve covered how to research and write up a high-quality literature review chapter. Let’s do a quick recap of the key takeaways:

• It is essential to understand the WHY of the literature review before you read or write anything. Make sure you understand the 4 core functions of the process.
• The first step is to hunt down the relevant literature . You can do this using Google Scholar, your university database, the snowballing technique and by reviewing other dissertations and theses.
• Next, you need to log all the articles in your reference manager , build your own catalogue of literature and synthesise all the research.
• Following that, you need to develop a detailed outline of your entire chapter – the more detail the better. Don’t start writing without a clear outline (on paper, not in your head!)
• Write up your first draft in rough form – don’t aim for perfection. Remember, done beats perfect.
• Refine your second draft and get a layman’s perspective on it . Then tighten it up and submit it to your supervisor.

Psst… there’s more!

This post is an extract from our bestselling short course, Literature Review Bootcamp . If you want to work smart, you don't want to miss this .

You Might Also Like:

38 Comments

Thank you very much. This page is an eye opener and easy to comprehend.

This is awesome!

I wish I come across GradCoach earlier enough.

But all the same I’ll make use of this opportunity to the fullest.

Thank you for this good job.

Keep it up!

You’re welcome, Yinka. Thank you for the kind words. All the best writing your literature review.

Thank you for a very useful literature review session. Although I am doing most of the steps…it being my first masters an Mphil is a self study and one not sure you are on the right track. I have an amazing supervisor but one also knows they are super busy. So not wanting to bother on the minutae. Thank you.

You’re most welcome, Renee. Good luck with your literature review 🙂

This has been really helpful. Will make full use of it. 🙂

Thank you Gradcoach.

Really agreed. Admirable effort

thank you for this beautiful well explained recap.

Thank you so much for your guide of video and other instructions for the dissertation writing.

It is instrumental. It encouraged me to write a dissertation now.

Thank you the video was great – from someone that knows nothing thankyou

an amazing and very constructive way of presetting a topic, very useful, thanks for the effort,

It is timely

It is very good video of guidance for writing a research proposal and a dissertation. Since I have been watching and reading instructions, I have started my research proposal to write. I appreciate to Mr Jansen hugely.

I learn a lot from your videos. Very comprehensive and detailed.

Thank you for sharing your knowledge. As a research student, you learn better with your learning tips in research

I was really stuck in reading and gathering information but after watching these things are cleared thanks, it is so helpful.

Really helpful, Thank you for the effort in showing such information

This is super helpful thank you very much.

Thank you for this whole literature writing review.You have simplified the process.

I’m so glad I found GradCoach. Excellent information, Clear explanation, and Easy to follow, Many thanks Derek!

You’re welcome, Maithe. Good luck writing your literature review 🙂

Thank you Coach, you have greatly enriched and improved my knowledge

Great piece, so enriching and it is going to help me a great lot in my project and thesis, thanks so much

This is THE BEST site for ANYONE doing a masters or doctorate! Thank you for the sound advice and templates. You rock!

Thanks, Stephanie 🙂

This is mind blowing, the detailed explanation and simplicity is perfect.

I am doing two papers on my final year thesis, and I must stay I feel very confident to face both headlong after reading this article.

thank you so much.

if anyone is to get a paper done on time and in the best way possible, GRADCOACH is certainly the go to area!

This is very good video which is well explained with detailed explanation

Thank you excellent piece of work and great mentoring

Thanks, it was useful

Thank you very much. the video and the information were very helpful.

Good morning scholar. I’m delighted coming to know you even before the commencement of my dissertation which hopefully is expected in not more than six months from now. I would love to engage my study under your guidance from the beginning to the end. I love to know how to do good job

Thank you so much Derek for such useful information on writing up a good literature review. I am at a stage where I need to start writing my one. My proposal was accepted late last year but I honestly did not know where to start

Like the name of your YouTube implies you are GRAD (great,resource person, about dissertation). In short you are smart enough in coaching research work.

This is a very well thought out webpage. Very informative and a great read.

Very timely.

I appreciate.

Very comprehensive and eye opener for me as beginner in postgraduate study. Well explained and easy to understand. Appreciate and good reference in guiding me in my research journey. Thank you

Thank you. I requested to download the free literature review template, however, your website wouldn’t allow me to complete the request or complete a download. May I request that you email me the free template? Thank you.

Submit a Comment Cancel reply

Your email address will not be published. Required fields are marked *

Save my name, email, and website in this browser for the next time I comment.

• Print Friendly

Purdue Online Writing Lab Purdue OWL® College of Liberal Arts

Writing a Literature Review

Welcome to the Purdue OWL

This page is brought to you by the OWL at Purdue University. When printing this page, you must include the entire legal notice.

Copyright ©1995-2018 by The Writing Lab & The OWL at Purdue and Purdue University. All rights reserved. This material may not be published, reproduced, broadcast, rewritten, or redistributed without permission. Use of this site constitutes acceptance of our terms and conditions of fair use.

A literature review is a document or section of a document that collects key sources on a topic and discusses those sources in conversation with each other (also called synthesis ). The lit review is an important genre in many disciplines, not just literature (i.e., the study of works of literature such as novels and plays). When we say “literature review” or refer to “the literature,” we are talking about the research ( scholarship ) in a given field. You will often see the terms “the research,” “the scholarship,” and “the literature” used mostly interchangeably.

Where, when, and why would I write a lit review?

There are a number of different situations where you might write a literature review, each with slightly different expectations; different disciplines, too, have field-specific expectations for what a literature review is and does. For instance, in the humanities, authors might include more overt argumentation and interpretation of source material in their literature reviews, whereas in the sciences, authors are more likely to report study designs and results in their literature reviews; these differences reflect these disciplines’ purposes and conventions in scholarship. You should always look at examples from your own discipline and talk to professors or mentors in your field to be sure you understand your discipline’s conventions, for literature reviews as well as for any other genre.

A literature review can be a part of a research paper or scholarly article, usually falling after the introduction and before the research methods sections. In these cases, the lit review just needs to cover scholarship that is important to the issue you are writing about; sometimes it will also cover key sources that informed your research methodology.

Lit reviews can also be standalone pieces, either as assignments in a class or as publications. In a class, a lit review may be assigned to help students familiarize themselves with a topic and with scholarship in their field, get an idea of the other researchers working on the topic they’re interested in, find gaps in existing research in order to propose new projects, and/or develop a theoretical framework and methodology for later research. As a publication, a lit review usually is meant to help make other scholars’ lives easier by collecting and summarizing, synthesizing, and analyzing existing research on a topic. This can be especially helpful for students or scholars getting into a new research area, or for directing an entire community of scholars toward questions that have not yet been answered.

What are the parts of a lit review?

Most lit reviews use a basic introduction-body-conclusion structure; if your lit review is part of a larger paper, the introduction and conclusion pieces may be just a few sentences while you focus most of your attention on the body. If your lit review is a standalone piece, the introduction and conclusion take up more space and give you a place to discuss your goals, research methods, and conclusions separately from where you discuss the literature itself.

Introduction:

• An introductory paragraph that explains what your working topic and thesis is
• A forecast of key topics or texts that will appear in the review
• Potentially, a description of how you found sources and how you analyzed them for inclusion and discussion in the review (more often found in published, standalone literature reviews than in lit review sections in an article or research paper)
• Summarize and synthesize: Give an overview of the main points of each source and combine them into a coherent whole
• Analyze and interpret: Don’t just paraphrase other researchers – add your own interpretations where possible, discussing the significance of findings in relation to the literature as a whole
• Critically Evaluate: Mention the strengths and weaknesses of your sources
• Write in well-structured paragraphs: Use transition words and topic sentence to draw connections, comparisons, and contrasts.

Conclusion:

• Summarize the key findings you have taken from the literature and emphasize their significance
• Connect it back to your primary research question

How should I organize my lit review?

Lit reviews can take many different organizational patterns depending on what you are trying to accomplish with the review. Here are some examples:

• Chronological : The simplest approach is to trace the development of the topic over time, which helps familiarize the audience with the topic (for instance if you are introducing something that is not commonly known in your field). If you choose this strategy, be careful to avoid simply listing and summarizing sources in order. Try to analyze the patterns, turning points, and key debates that have shaped the direction of the field. Give your interpretation of how and why certain developments occurred (as mentioned previously, this may not be appropriate in your discipline — check with a teacher or mentor if you’re unsure).
• Thematic : If you have found some recurring central themes that you will continue working with throughout your piece, you can organize your literature review into subsections that address different aspects of the topic. For example, if you are reviewing literature about women and religion, key themes can include the role of women in churches and the religious attitude towards women.
• Qualitative versus quantitative research
• Empirical versus theoretical scholarship
• Divide the research by sociological, historical, or cultural sources
• Theoretical : In many humanities articles, the literature review is the foundation for the theoretical framework. You can use it to discuss various theories, models, and definitions of key concepts. You can argue for the relevance of a specific theoretical approach or combine various theorical concepts to create a framework for your research.

What are some strategies or tips I can use while writing my lit review?

Any lit review is only as good as the research it discusses; make sure your sources are well-chosen and your research is thorough. Don’t be afraid to do more research if you discover a new thread as you’re writing. More info on the research process is available in our "Conducting Research" resources .

As you’re doing your research, create an annotated bibliography ( see our page on the this type of document ). Much of the information used in an annotated bibliography can be used also in a literature review, so you’ll be not only partially drafting your lit review as you research, but also developing your sense of the larger conversation going on among scholars, professionals, and any other stakeholders in your topic.

Usually you will need to synthesize research rather than just summarizing it. This means drawing connections between sources to create a picture of the scholarly conversation on a topic over time. Many student writers struggle to synthesize because they feel they don’t have anything to add to the scholars they are citing; here are some strategies to help you:

• It often helps to remember that the point of these kinds of syntheses is to show your readers how you understand your research, to help them read the rest of your paper.
• Writing teachers often say synthesis is like hosting a dinner party: imagine all your sources are together in a room, discussing your topic. What are they saying to each other?
• Look at the in-text citations in each paragraph. Are you citing just one source for each paragraph? This usually indicates summary only. When you have multiple sources cited in a paragraph, you are more likely to be synthesizing them (not always, but often
• Read more about synthesis here.

The most interesting literature reviews are often written as arguments (again, as mentioned at the beginning of the page, this is discipline-specific and doesn’t work for all situations). Often, the literature review is where you can establish your research as filling a particular gap or as relevant in a particular way. You have some chance to do this in your introduction in an article, but the literature review section gives a more extended opportunity to establish the conversation in the way you would like your readers to see it. You can choose the intellectual lineage you would like to be part of and whose definitions matter most to your thinking (mostly humanities-specific, but this goes for sciences as well). In addressing these points, you argue for your place in the conversation, which tends to make the lit review more compelling than a simple reporting of other sources.

• Resources Home 🏠
• Try SciSpace Copilot
• Search research papers
• Add Copilot Extension
• Try AI Detector
• Try Paraphraser
• Try Citation Generator
• April Papers
• June Papers
• July Papers

How To Write A Literature Review - A Complete Guide

Table of Contents

A literature review is much more than just another section in your research paper. It forms the very foundation of your research. It is a formal piece of writing where you analyze the existing theoretical framework, principles, and assumptions and use that as a base to shape your approach to the research question.

Curating and drafting a solid literature review section not only lends more credibility to your research paper but also makes your research tighter and better focused. But, writing literature reviews is a difficult task. It requires extensive reading, plus you have to consider market trends and technological and political changes, which tend to change in the blink of an eye.

Now streamline your literature review process with the help of SciSpace Copilot. With this AI research assistant, you can efficiently synthesize and analyze a vast amount of information, identify key themes and trends, and uncover gaps in the existing research. Get real-time explanations, summaries, and answers to your questions for the paper you're reviewing, making navigating and understanding the complex literature landscape easier.

In this comprehensive guide, we will explore everything from the definition of a literature review, its appropriate length, various types of literature reviews, and how to write one.

What is a literature review?

A literature review is a collation of survey, research, critical evaluation, and assessment of the existing literature in a preferred domain.

Eminent researcher and academic Arlene Fink, in her book Conducting Research Literature Reviews , defines it as the following:

“A literature review surveys books, scholarly articles, and any other sources relevant to a particular issue, area of research, or theory, and by so doing, provides a description, summary, and critical evaluation of these works in relation to the research problem being investigated.

Literature reviews are designed to provide an overview of sources you have explored while researching a particular topic, and to demonstrate to your readers how your research fits within a larger field of study.”

Simply put, a literature review can be defined as a critical discussion of relevant pre-existing research around your research question and carving out a definitive place for your study in the existing body of knowledge. Literature reviews can be presented in multiple ways: a section of an article, the whole research paper itself, or a chapter of your thesis.

A literature review does function as a summary of sources, but it also allows you to analyze further, interpret, and examine the stated theories, methods, viewpoints, and, of course, the gaps in the existing content.

As an author, you can discuss and interpret the research question and its various aspects and debate your adopted methods to support the claim.

What is the purpose of a literature review?

A literature review is meant to help your readers understand the relevance of your research question and where it fits within the existing body of knowledge. As a researcher, you should use it to set the context, build your argument, and establish the need for your study.

What is the importance of a literature review?

The literature review is a critical part of research papers because it helps you:

• Gain an in-depth understanding of your research question and the surrounding area
• Convey that you have a thorough understanding of your research area and are up-to-date with the latest changes and advancements
• Establish how your research is connected or builds on the existing body of knowledge and how it could contribute to further research
• Elaborate on the validity and suitability of your theoretical framework and research methodology
• Identify and highlight gaps and shortcomings in the existing body of knowledge and how things need to change
• Convey to readers how your study is different or how it contributes to the research area

How long should a literature review be?

Ideally, the literature review should take up 15%-40% of the total length of your manuscript. So, if you have a 10,000-word research paper, the minimum word count could be 1500.

Your literature review format depends heavily on the kind of manuscript you are writing — an entire chapter in case of doctoral theses, a part of the introductory section in a research article, to a full-fledged review article that examines the previously published research on a topic.

Another determining factor is the type of research you are doing. The literature review section tends to be longer for secondary research projects than primary research projects.

What are the different types of literature reviews?

All literature reviews are not the same. There are a variety of possible approaches that you can take. It all depends on the type of research you are pursuing.

Here are the different types of literature reviews:

Argumentative review

It is called an argumentative review when you carefully present literature that only supports or counters a specific argument or premise to establish a viewpoint.

Integrative review

It is a type of literature review focused on building a comprehensive understanding of a topic by combining available theoretical frameworks and empirical evidence.

Methodological review

This approach delves into the ''how'' and the ''what" of the research question —  you cannot look at the outcome in isolation; you should also review the methodology used.

Systematic review

This form consists of an overview of existing evidence pertinent to a clearly formulated research question, which uses pre-specified and standardized methods to identify and critically appraise relevant research and collect, report, and analyze data from the studies included in the review.

Meta-analysis review

Meta-analysis uses statistical methods to summarize the results of independent studies. By combining information from all relevant studies, meta-analysis can provide more precise estimates of the effects than those derived from the individual studies included within a review.

Historical review

Historical literature reviews focus on examining research throughout a period, often starting with the first time an issue, concept, theory, or phenomenon emerged in the literature, then tracing its evolution within the scholarship of a discipline. The purpose is to place research in a historical context to show familiarity with state-of-the-art developments and identify future research's likely directions.

Theoretical Review

This form aims to examine the corpus of theory accumulated regarding an issue, concept, theory, and phenomenon. The theoretical literature review helps to establish what theories exist, the relationships between them, the degree the existing approaches have been investigated, and to develop new hypotheses to be tested.

Scoping Review

The Scoping Review is often used at the beginning of an article, dissertation, or research proposal. It is conducted before the research to highlight gaps in the existing body of knowledge and explains why the project should be greenlit.

State-of-the-Art Review

The State-of-the-Art review is conducted periodically, focusing on the most recent research. It describes what is currently known, understood, or agreed upon regarding the research topic and highlights where there are still disagreements.

Can you use the first person in a literature review?

When writing literature reviews, you should avoid the usage of first-person pronouns. It means that instead of "I argue that" or "we argue that," the appropriate expression would be "this research paper argues that."

Do you need an abstract for a literature review?

Ideally, yes. It is always good to have a condensed summary that is self-contained and independent of the rest of your review. As for how to draft one, you can follow the same fundamental idea when preparing an abstract for a literature review. It should also include:

• The research topic and your motivation behind selecting it
• A one-sentence thesis statement
• An explanation of the kinds of literature featured in the review
• Summary of what you've learned
• Conclusions you drew from the literature you reviewed
• Potential implications and future scope for research

Here's an example of the abstract of a literature review

Is a literature review written in the past tense?

Yes, the literature review should ideally be written in the past tense. You should not use the present or future tense when writing one. The exceptions are when you have statements describing events that happened earlier than the literature you are reviewing or events that are currently occurring; then, you can use the past perfect or present perfect tenses.

How many sources for a literature review?

There are multiple approaches to deciding how many sources to include in a literature review section. The first approach would be to look level you are at as a researcher. For instance, a doctoral thesis might need 60+ sources. In contrast, you might only need to refer to 5-15 sources at the undergraduate level.

The second approach is based on the kind of literature review you are doing — whether it is merely a chapter of your paper or if it is a self-contained paper in itself. When it is just a chapter, sources should equal the total number of pages in your article's body. In the second scenario, you need at least three times as many sources as there are pages in your work.

Quick tips on how to write a literature review

To know how to write a literature review, you must clearly understand its impact and role in establishing your work as substantive research material.

You need to follow the below-mentioned steps, to write a literature review:

• Outline the purpose behind the literature review
• Search relevant literature
• Examine and assess the relevant resources
• Discover connections by drawing deep insights from the resources
• Structure planning to write a good literature review

1. Outline and identify the purpose of  a literature review

As a first step on how to write a literature review, you must know what the research question or topic is and what shape you want your literature review to take. Ensure you understand the research topic inside out, or else seek clarifications. You must be able to the answer below questions before you start:

• How many sources do I need to include?
• What kind of sources should I analyze?
• How much should I critically evaluate each source?
• Should I summarize, synthesize or offer a critique of the sources?
• Do I need to include any background information or definitions?

Additionally, you should know that the narrower your research topic is, the swifter it will be for you to restrict the number of sources to be analyzed.

2. Search relevant literature

Dig deeper into search engines to discover what has already been published around your chosen topic. Make sure you thoroughly go through appropriate reference sources like books, reports, journal articles, government docs, and web-based resources.

You must prepare a list of keywords and their different variations. You can start your search from any library’s catalog, provided you are an active member of that institution. The exact keywords can be extended to widen your research over other databases and academic search engines like:

• Google Scholar
• Microsoft Academic
• Science.gov

Besides, it is not advisable to go through every resource word by word. Alternatively, what you can do is you can start by reading the abstract and then decide whether that source is relevant to your research or not.

Additionally, you must spend surplus time assessing the quality and relevance of resources. It would help if you tried preparing a list of citations to ensure that there lies no repetition of authors, publications, or articles in the literature review.

3. Examine and assess the sources

It is nearly impossible for you to go through every detail in the research article. So rather than trying to fetch every detail, you have to analyze and decide which research sources resemble closest and appear relevant to your chosen domain.

While analyzing the sources, you should look to find out answers to questions like:

• What question or problem has the author been describing and debating?
• What is the definition of critical aspects?
• How well the theories, approach, and methodology have been explained?
• Whether the research theory used some conventional or new innovative approach?
• How relevant are the key findings of the work?
• In what ways does it relate to other sources on the same topic?
• What challenges does this research paper pose to the existing theory
• What are the possible contributions or benefits it adds to the subject domain?

Be always mindful that you refer only to credible and authentic resources. It would be best if you always take references from different publications to validate your theory.

Always keep track of important information or data you can present in your literature review right from the beginning. It will help steer your path from any threats of plagiarism and also make it easier to curate an annotated bibliography or reference section.

4. Discover connections

At this stage, you must start deciding on the argument and structure of your literature review. To accomplish this, you must discover and identify the relations and connections between various resources while drafting your abstract.

A few aspects that you should be aware of while writing a literature review include:

• Rise to prominence: Theories and methods that have gained reputation and supporters over time.
• Constant scrutiny: Concepts or theories that repeatedly went under examination.
• Contradictions and conflicts: Theories, both the supporting and the contradictory ones, for the research topic.
• Knowledge gaps: What exactly does it fail to address, and how to bridge them with further research?
• Influential resources: Significant research projects available that have been upheld as milestones or perhaps, something that can modify the current trends

Once you join the dots between various past research works, it will be easier for you to draw a conclusion and identify your contribution to the existing knowledge base.

5. Structure planning to write a good literature review

There exist different ways towards planning and executing the structure of a literature review. The format of a literature review varies and depends upon the length of the research.

Like any other research paper, the literature review format must contain three sections: introduction, body, and conclusion. The goals and objectives of the research question determine what goes inside these three sections.

Nevertheless, a good literature review can be structured according to the chronological, thematic, methodological, or theoretical framework approach.

Literature review samples

1. Standalone

2. As a section of a research paper

How SciSpace Discover makes literature review a breeze?

SciSpace Discover is a one-stop solution to do an effective literature search and get barrier-free access to scientific knowledge. It is an excellent repository where you can find millions of only peer-reviewed articles and full-text PDF files. Here’s more on how you can use it:

Find the right information

Find what you want quickly and easily with comprehensive search filters that let you narrow down papers according to PDF availability, year of publishing, document type, and affiliated institution. Moreover, you can sort the results based on the publishing date, citation count, and relevance.

Assess credibility of papers quickly

When doing the literature review, it is critical to establish the quality of your sources. They form the foundation of your research. SciSpace Discover helps you assess the quality of a source by providing an overview of its references, citations, and performance metrics.

Get the complete picture in no time

SciSpace Discover’s personalized suggestion engine helps you stay on course and get the complete picture of the topic from one place. Every time you visit an article page, it provides you links to related papers. Besides that, it helps you understand what’s trending, who are the top authors, and who are the leading publishers on a topic.

Make referring sources super easy

To ensure you don't lose track of your sources, you must start noting down your references when doing the literature review. SciSpace Discover makes this step effortless. Click the 'cite' button on an article page, and you will receive preloaded citation text in multiple styles — all you've to do is copy-paste it into your manuscript.

Final tips on how to write a literature review

A massive chunk of time and effort is required to write a good literature review. But, if you go about it systematically, you'll be able to save a ton of time and build a solid foundation for your research.

We hope this guide has helped you answer several key questions you have about writing literature reviews.

Would you like to explore SciSpace Discover and kick off your literature search right away? You can get started here .

Frequently Asked Questions (FAQs)

1. how to start a literature review.

• What questions do you want to answer?

• What sources do you need to answer these questions?

• What information do these sources contain?

• How can you use this information to answer your questions?

2. What to include in a literature review?

• A brief background of the problem or issue

• What has previously been done to address the problem or issue

• A description of what you will do in your project

• How this study will contribute to research on the subject

3. Why literature review is important?

The literature review is an important part of any research project because it allows the writer to look at previous studies on a topic and determine existing gaps in the literature, as well as what has already been done. It will also help them to choose the most appropriate method for their own study.

4. How to cite a literature review in APA format?

To cite a literature review in APA style, you need to provide the author's name, the title of the article, and the year of publication. For example: Patel, A. B., & Stokes, G. S. (2012). The relationship between personality and intelligence: A meta-analysis of longitudinal research. Personality and Individual Differences, 53(1), 16-21

5. What are the components of a literature review?

• A brief introduction to the topic, including its background and context. The introduction should also include a rationale for why the study is being conducted and what it will accomplish.

• A description of the methodologies used in the study. This can include information about data collection methods, sample size, and statistical analyses.

• A presentation of the findings in an organized format that helps readers follow along with the author's conclusions.

6. What are common errors in writing literature review?

• Not spending enough time to critically evaluate the relevance of resources, observations and conclusions.

• Totally relying on secondary data while ignoring primary data.

• Letting your personal bias seep into your interpretation of existing literature.

• No detailed explanation of the procedure to discover and identify an appropriate literature review.

7. What are the 5 C's of writing literature review?

• Cite - the sources you utilized and referenced in your research.

• Compare - existing arguments, hypotheses, methodologies, and conclusions found in the knowledge base.

• Contrast - the arguments, topics, methodologies, approaches, and disputes that may be found in the literature.

• Critique - the literature and describe the ideas and opinions you find more convincing and why.

• Connect - the various studies you reviewed in your research.

8. How many sources should a literature review have?

When it is just a chapter, sources should equal the total number of pages in your article's body. if it is a self-contained paper in itself, you need at least three times as many sources as there are pages in your work.

9. Can literature review have diagrams?

• To represent an abstract idea or concept

• To explain the steps of a process or procedure

• To help readers understand the relationships between different concepts

10. How old should sources be in a literature review?

Sources for a literature review should be as current as possible or not older than ten years. The only exception to this rule is if you are reviewing a historical topic and need to use older sources.

11. What are the types of literature review?

• Argumentative review

• Integrative review

• Methodological review

• Systematic review

• Meta-analysis review

• Historical review

• Theoretical review

• Scoping review

• State-of-the-Art review

12. Is a literature review mandatory?

Yes. Literature review is a mandatory part of any research project. It is a critical step in the process that allows you to establish the scope of your research, and provide a background for the rest of your work.

But before you go,

• Six Online Tools for Easy Literature Review
• Evaluating literature review: systematic vs. scoping reviews
• Systematic Approaches to a Successful Literature Review
• Writing Integrative Literature Reviews: Guidelines and Examples

You might also like

Consensus GPT vs. SciSpace GPT: Choose the Best GPT for Research

Literature Review and Theoretical Framework: Understanding the Differences

Types of Essays in Academic Writing - Quick Guide (2024)

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• CAREER FEATURE
• 04 December 2020
• Correction 09 December 2020

How to write a superb literature review

Andy Tay is a freelance writer based in Singapore.

You can also search for this author in PubMed   Google Scholar

Literature reviews are important resources for scientists. They provide historical context for a field while offering opinions on its future trajectory. Creating them can provide inspiration for one’s own research, as well as some practice in writing. But few scientists are trained in how to write a review — or in what constitutes an excellent one. Even picking the appropriate software to use can be an involved decision (see ‘Tools and techniques’). So Nature asked editors and working scientists with well-cited reviews for their tips.

Access options

Access Nature and 54 other Nature Portfolio journals

Get Nature+, our best-value online-access subscription

24,99 € / 30 days

cancel any time

Subscribe to this journal

Receive 51 print issues and online access

185,98 € per year

only 3,65 € per issue

Rent or buy this article

Prices vary by article type

Prices may be subject to local taxes which are calculated during checkout

doi: https://doi.org/10.1038/d41586-020-03422-x

Interviews have been edited for length and clarity.

Updates & Corrections

Correction 09 December 2020 : An earlier version of the tables in this article included some incorrect details about the programs Zotero, Endnote and Manubot. These have now been corrected.

Hsing, I.-M., Xu, Y. & Zhao, W. Electroanalysis 19 , 755–768 (2007).

Article   Google Scholar  

Ledesma, H. A. et al. Nature Nanotechnol. 14 , 645–657 (2019).

Article   PubMed   Google Scholar  

Brahlek, M., Koirala, N., Bansal, N. & Oh, S. Solid State Commun. 215–216 , 54–62 (2015).

Choi, Y. & Lee, S. Y. Nature Rev. Chem . https://doi.org/10.1038/s41570-020-00221-w (2020).

Download references

Related Articles

• Research management

What’s the state of hiring researchers in science? Share your insights with Nature

Career News 19 JUN 24

How researchers and their managers can build an actionable career-development plan

Career Column 17 JUN 24

Tiny beauty: how I make scientific art from behind the microscope

Career Feature 17 JUN 24

Three ways to recognize hidden labour in research

Nature Index 13 JUN 24

‘It can feel like there’s no way out’ — political scientists face pushback on their work

News Feature 19 JUN 24

How climate change is hitting Europe: three graphics reveal health impacts

News 18 JUN 24

Twelve scientist-endorsed tips to get over writer’s block

Career Feature 13 JUN 24

Endowed Chair in Macular Degeneration Research

Dallas, Texas (US)

The University of Texas Southwestern Medical Center (UT Southwestern Medical Center)

Postdoctoral Fellow

Postdoc positions on ERC projects – cellular stress responses, proteostasis and autophagy

Frankfurt am Main, Hessen (DE)

Goethe University (GU) Frankfurt am Main - Institute of Molecular Systems Medicine

ZJU 100 Young Professor

Promising young scholars who can independently establish and develop a research direction.

Hangzhou, Zhejiang, China

Zhejiang University

Qiushi Chair Professor

Distinguished scholars with notable achievements and extensive international influence.

Research Postdoctoral Fellow - MD

Houston, Texas (US)

Baylor College of Medicine (BCM)

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

• University of Oregon Libraries
• Research Guides

How to Write a Literature Review

• 7. Write a Literature Review
• Literature Reviews: A Recap
• Reading Journal Articles
• Does it Describe a Literature Review?
• 1. Identify the Question
• 2. Review Discipline Styles
• Searching Article Databases
• Finding Full-Text of an Article
• Citation Chaining
• When to Stop Searching
• 4. Manage Your References
• 5. Critically Analyze and Evaluate
• 6. Synthesize

Write a Literature Review

Writing support on campus, need more help.

Photo Credit: UO Libraries

Some points to remember

• Include only the most important points from each source -- you want to digest, not quote from, the sources.
• The value of the review for you audience will consist in a clear, well-organized synopsis of what has been found so far on your topic. 
• Avoid plagiarism in your lit review. Consult this UO Libraries tutorial on Academic Integrity if you need some guidance.

If you would like more pointers about how to approach your literature review, this this handout from The Writing Center at UNC-Chapel Hill  suggests several effective strategies.

From UNC-Chapel Hill  and  University of Toronto

Note : Please check the websites below for availability of online or remote services:

• Writing Lab Service Customized academic assistance for all international students
• How to Write a Literature Review (UO Libraries tutorial)
• Exploring Academic Integrity in Your Research

If you have questions related to a field or discipline, consider reaching out to a Subject Librarian by email, phone, or by scheduling an appointment for a free consultation:

• Subject Librarians
• << Previous: 6. Synthesize
• Last Updated: May 3, 2024 5:17 PM
• URL: https://researchguides.uoregon.edu/litreview

Contact Us Library Accessibility UO Libraries Privacy Notices and Procedures

1501 Kincaid Street Eugene, OR 97403 P: 541-346-3053 F: 541-346-3485

• Visit us on Facebook
• Visit us on Twitter
• Visit us on Youtube
• Visit us on Instagram
• Report a Concern
• Nondiscrimination and Title IX
• Accessibility
• Privacy Policy
• Find People

Reference management. Clean and simple.

Literature review

How to write a literature review in 6 steps

How do you write a good literature review? This step-by-step guide on how to write an excellent literature review covers all aspects of planning and writing literature reviews for academic papers and theses.

How to write a systematic literature review [9 steps]

How do you write a systematic literature review? What types of systematic literature reviews exist and where do you use them? Learn everything you need to know about a systematic literature review in this guide

What is a literature review? [with examples]

Not sure what a literature review is? This guide covers the definition, purpose, and format of a literature review.

How to Write a Literature Review: Six Steps to Get You from Start to Finish

Writing-a-literature-review-six-steps-to-get-you-from-start-to-finish.

Tanya Golash-Boza, Associate Professor of Sociology, University of California

February 03, 2022

Writing a literature review is often the most daunting part of writing an article, book, thesis, or dissertation. “The literature” seems (and often is) massive. I have found it helpful to be as systematic as possible when completing this gargantuan task.

Sonja Foss and William Walters* describe an efficient and effective way of writing a literature review. Their system provides an excellent guide for getting through the massive amounts of literature for any purpose: in a dissertation, an M.A. thesis, or preparing a research article for publication  in any field of study. Below is a  summary of the steps they outline as well as a step-by-step method for writing a literature review.

How to Write a Literature Review

Step One: Decide on your areas of research:

Before you begin to search for articles or books, decide beforehand what areas you are going to research. Make sure that you only get articles and books in those areas, even if you come across fascinating books in other areas. A literature review I am currently working on, for example, explores barriers to higher education for undocumented students.

Step Two: Search for the literature:

Conduct a comprehensive bibliographic search of books and articles in your area. Read the abstracts online and download and/or print those articles that pertain to your area of research. Find books in the library that are relevant and check them out. Set a specific time frame for how long you will search. It should not take more than two or three dedicated sessions.

Step Three: Find relevant excerpts in your books and articles:

Skim the contents of each book and article and look specifically for these five things:

1. Claims, conclusions, and findings about the constructs you are investigating

2. Definitions of terms

3. Calls for follow-up studies relevant to your project

4. Gaps you notice in the literature

5. Disagreement about the constructs you are investigating

When you find any of these five things, type the relevant excerpt directly into a Word document. Don’t summarize, as summarizing takes longer than simply typing the excerpt. Make sure to note the name of the author and the page number following each excerpt. Do this for each article and book that you have in your stack of literature. When you are done, print out your excerpts.

Step Four: Code the literature:

Get out a pair of scissors and cut each excerpt out. Now, sort the pieces of paper into similar topics. Figure out what the main themes are. Place each excerpt into a themed pile. Make sure each note goes into a pile. If there are excerpts that you can’t figure out where they belong, separate those and go over them again at the end to see if you need new categories. When you finish, place each stack of notes into an envelope labeled with the name of the theme.

Step Five: Create Your Conceptual Schema:

Type, in large font, the name of each of your coded themes. Print this out, and cut the titles into individual slips of paper. Take the slips of paper to a table or large workspace and figure out the best way to organize them. Are there ideas that go together or that are in dialogue with each other? Are there ideas that contradict each other? Move around the slips of paper until you come up with a way of organizing the codes that makes sense. Write the conceptual schema down before you forget or someone cleans up your slips of paper.

Step Six: Begin to Write Your Literature Review:

Choose any section of your conceptual schema to begin with. You can begin anywhere, because you already know the order. Find the envelope with the excerpts in them and lay them on the table in front of you. Figure out a mini-conceptual schema based on that theme by grouping together those excerpts that say the same thing. Use that mini-conceptual schema to write up your literature review based on the excerpts that you have in front of you. Don’t forget to include the citations as you write, so as not to lose track of who said what. Repeat this for each section of your literature review.

Once you complete these six steps, you will have a complete draft of your literature review. The great thing about this process is that it breaks down into manageable steps something that seems enormous: writing a literature review.

I think that Foss and Walter’s system for writing the literature review is ideal for a dissertation, because a Ph.D. candidate has already read widely in his or her field through graduate seminars and comprehensive exams.

It may be more challenging for M.A. students, unless you are already familiar with the literature. It is always hard to figure out how much you need to read for deep meaning, and how much you just need to know what others have said. That balance will depend on how much you already know.

For people writing literature reviews for articles or books, this system also could work, especially when you are writing in a field with which you are already familiar. The mere fact of having a system can make the literature review seem much less daunting, so I recommend this system for anyone who feels overwhelmed by the prospect of writing a literature review.

*Destination Dissertation: A Traveler's Guide to a Done Dissertation

Image Credit/Source: Goldmund Lukic/Getty Images

Watch our Webinar to help you get published

Please enter your Email Address

Please enter valid email address

Please Enter your First Name

Please enter your Last Name

Please enter your Questions or Comments.

Please enter the Privacy

Please enter the Terms & Conditions

How research content supports academic integrity

Finding time to publish as a medical student: 6 tips for Success

Software to Improve Reliability of Research Image Data: Wiley, Lumina, and Researchers at Harvard Medical School Work Together on Solutions

Driving Research Outcomes: Wiley Partners with CiteAb

ISBN, ISSN, DOI: what they are and how to find them

Image Collections for Medical Practitioners with TDS Health

How do you Discover Content?

Writing for Publication for Nurses (Mandarin Edition)

Get Published - Your How to Webinar

Finding time to publish as a medical student: 6 tips for success

Related articles.

Learn how Wiley partners with plagiarism detection services to support academic integrity around the world

Medical student Nicole Foley shares her top tips for writing and getting your work published.

Wiley and Lumina are working together to support the efforts of researchers at Harvard Medical School to develop and test new machine learning tools and artificial intelligence (AI) software that can

Learn more about our relationship with a company that helps scientists identify the right products to use in their research

What is ISBN? ISSN? DOI? Learn about some of the unique identifiers for book and journal content.

Learn how medical practitioners can easily access and search visual assets from our article portfolio

Explore free-to-use services that can help you discover new content

Watch this webinar to help you learn how to get published.

How to Easily Access the Most Relevant Research: A Q&A With the Creator of Scitrus

Atypon launches Scitrus, a personalized web app that allows users to create a customized feed of the latest research.

Effectively and Efficiently Creating your Paper

FOR INDIVIDUALS

FOR INSTITUTIONS & BUSINESSES

WILEY NETWORK

ABOUT WILEY

Corporate Responsibility

Corporate Governance

Leadership Team

Cookie Preferences

Copyright @ 2000-2024  by John Wiley & Sons, Inc., or related companies. All rights reserved, including rights for text and data mining and training of artificial technologies or similar technologies.

Rights & Permissions

Privacy Policy

Terms of Use

Literature Reviews

• 6. Write the review
• Getting started
• Types of reviews
• 1. Define your research question
• 2. Plan your search
• 3. Search the literature
• 4. Organize your results
• 5. Synthesize your findings
• Artificial intelligence (AI) tools
• Thompson Writing Studio This link opens in a new window
• Need to write a systematic review? This link opens in a new window

Contact a Librarian

Ask a Librarian

Organize your review according to the following structure:

• Provide a concise overview of your primary thesis and the studies you explore in your review.
• Present the subject of your review
• Outline the key points you will address in the review
• Use your thesis to frame your paper
• Explain the significance of reviewing the literature in your chosen topic area (e.g., to find research gaps? Or to update your field on the current literature?)
• Consider dividing it into sections, particularly if examining multiple methodologies
• Examine the literature thoroughly and systematically, maintaining organization — don't just paraphrase researchers, add your own interpretation and discuss the significance of the papers you found)
• Reiterate your thesis
• Summarize your key findings 
• Ensure proper formatting of your references (stick to a single citation style — be consistent!)
• Use a citation manager, such as Zotero or EndNote, for easy formatting!

Check out UNC's guide on literature reviews, especially the section " Organizing the Body ."

• << Previous: 5. Synthesize your findings
• Next: Artificial intelligence (AI) tools >>
• Last Updated: Jun 13, 2024 10:06 AM
• URL: https://guides.library.duke.edu/litreviews

Services for...

• Faculty & Instructors
• Graduate Students
• Undergraduate Students
• International Students
• Patrons with Disabilities

• Harmful Language Statement
• Re-use & Attribution / Privacy
• Support the Libraries

How Long Does It Take to Write a Literature Review

Featured In

Table of contents, what is a literature review, what’s the purpose of a literature review, what is the importance of a literature review, how long should a literature review be, what are the different types of literature reviews, how long does it take to write a literature review paper, how long does it take to write a 1000 word literature review, how does a literature review differ from a research paper, how to write a literature review in 30 minutes or less, 9 essential tools to help write a literature review, 2. mendeley, 4. grammarly, 5. speechify tts, 6. google scholar, 7. microsoft word, 8. evernote, 9. turnitin, why tts is helpful in writing a literature review, can i write a literature review in one day, can i write a literature review in one week, is writing a literature review difficult, how long does it take to write a literature review for masters, does it take a lot of time to write a literature review.

The question "how long does it take to write a literature review?" is one that many students and researchers often ask, and for good reason. A literature...

The question "how long does it take to write a literature review?" is one that many students and researchers often ask, and for good reason. A literature review is a crucial part of any research project, academic paper, or doctoral research proposal. Understanding its length and complexity can help in planning and executing the writing process efficiently.

A literature review is a type of academic writing that provides an overview of existing research on a particular topic. It identifies, assesses, and synthesizes scholarly articles, research papers, and other relevant literature to inform the reader about the current state of research on a specific area of study.

The purpose of a literature review is multifaceted. It aims to identify gaps in existing research, provide background information on a research topic, validate the research question, and set the stage for your own research project. It enables researchers to understand the existing landscape of their field of study, thereby guiding their own research methodologies and questions.

The importance of a literature review is paramount in establishing the validity of your research paper or proposal. It helps in framing your research question and showcasing that your study is not a mere repetition, but rather an addition to existing knowledge. By summarizing previous research, it offers a point of view and creates a foundation for new research.

The length of a literature review can vary depending on the depth of the research topic and the guidelines set by a particular institution or journal. In most cases, literature reviews range from 2000 to 5000 words. However, for doctoral dissertations, it can be much more extensive.

1. Narrative Review

2. Systematic Review

3. Meta-analysis

4. Scoping Review

5. State-of-the-Art Review

Writing a literature review can take anywhere from several days to several weeks, depending on the breadth and depth of the subject matter. Researchers need to gather relevant literature, read through them, synthesize key findings, and finally, write the review article while following the appropriate research methodology and citations styles like APA.

A 1000-word literature review can generally be completed within a day or two, assuming that you have already completed the required reading and have a plan for your review. However, this duration can vary depending on the complexity of the topic and the need for extensive research.

While both are academic papers, a literature review summarizes and synthesizes existing research, whereas a research paper presents new research findings. A literature review can be a stand-alone paper or a review section within a larger research paper.

Writing a literature review in 30 minutes or less is unrealistic for most comprehensive reviews. However, you could potentially draft a very rough outline or jot down key points, citations, and topic sentences to be expanded upon later.

What Steps Should Follow to Write an Effective Literature Review?

1. Identify a Research Topic

2. Conduct a Literature Search

3. Read and Annotate

4. Organize and Outline

5. Write and Revise

Cost: Starts at $249.95 for a one-time purchase

EndNote is a reference management software widely used by researchers and graduate students alike. The tool allows users to store and organize citations for journal articles, books, and research papers, making it easier to cite these sources while writing the literature review. The automation feature is a massive time-saver, especially when handling complex citation styles like APA or MLA. With EndNote, users can search for additional journal articles and relevant literature directly within the platform, streamlining the process of gathering and managing resources for a review.

Top 5 Features:

- Reference management

- Citation automation

- Bibliography maker

- Search capabilities for journal articles

- Sync across multiple devices

Cost: Free basic plan

Mendeley is another robust tool for managing research papers and citations. The platform provides a PDF reader , allowing for easy annotations and highlighting directly within the software. The citation generator is another essential feature that simplifies the writing process, particularly when adhering to a particular citation style. Mendeley also offers collaboration features, enabling researchers to share references, notes, and even co-write documents, making it an excellent tool for group projects or multi-author literature reviews.

- PDF reader

- Collaboration with other researchers

- Citation generator

- Social networking for scientists

Zotero is a free, open-source tool that provides similar functionality to paid options like EndNote and Mendeley. One of its standout features is browser integration, allowing users to easily add citations and full-text articles directly from the web browser. The citation generator function supports multiple citation styles, including APA, MLA, and Chicago. Additionally, Zotero offers robust library organization features, making it easier to sort and access research materials for a literature review.

- Free and open-source

- Browser integration

- Library organization

- Annotation and note-taking

Cost: Free basic plan; Premium starts at $11.66/month

Grammarly is primarily known for its superior grammar-checking capabilities, but it offers much more. The tool's plagiarism checker is invaluable when writing literature reviews, as it ensures that your work is original and not unintentionally copied from other sources. The software also offers suggestions for improving writing style and word choice, making it easier to write a concise, coherent, and error-free literature review.

- Grammar checking

- Plagiarism detection

- Tone adjustment

- Style suggestions

- Word choice

Cost: Free basic plan; Premium starts at $6.99/month

Speechify TTS (Text-to-Speech) offers a different, auditory approach to reviewing written content. Graduate students and researchers often have to sift through vast amounts of text when crafting a literature review, and Speechify provides an alternative to reading, helping to improve comprehension and retention. The tool can read aloud existing literature or even your draft, enabling you to better understand the flow and transitions of your writing. It can also help you catch errors or awkward phrasing that may not be evident when reading. Text-to-speech technology has shown to be extremely helpful in writing a literature review.

- Text-to-Speech

- Speed adjustment

- Multiple languages

- Voice selection

- Offline listening

Google Scholar is a free search engine specifically for scholarly articles, theses, books, and conference papers. While it doesn't have the reference management features of EndNote or Mendeley, it is a goldmine of peer-reviewed papers and articles that can serve as primary material for your literature review. The "Cited by" feature also lets you see how many other papers have cited a particular piece of research, providing a measure of its influence or impact in the field.

- Free access to scholarly articles

- Citation export

- Case law search

- Patent search

- "Cited by" feature

Cost: Part of Microsoft 365, starting at $69.99/year

Microsoft Word might seem basic compared to specialized software, but it remains a vital tool for writing. The software offers numerous formatting options that align with various citation styles. The spellcheck and grammar features, although not as robust as Grammarly, provide a decent first pass at editing. Word also offers an outline view, ideal for structuring complex literature reviews before you dive into detailed writing.

- Spelling and grammar checker

- Extensive formatting options

- Outline view for structuring

- Collaboration features

- Templates

Cost: Free basic plan; Premium starts at $7.99/month

Evernote is an excellent tool for gathering and organizing your thoughts and resources before and during the writing process. The software lets you clip web pages and PDFs, annotate them, and organize them into notebooks. Evernote's powerful search feature makes retrieving these notes easy, making the writing process more streamlined and organized.

- Note-taking

- Web clipper

- Task management

- Annotation

Cost: Pricing varies; usually comes with institutional subscription

Turnitin is renowned for its plagiarism checking capabilities, making it indispensable when writing a literature review. The tool provides originality reports that highlight plagiarized content, thus helping writers make necessary revisions. Turnitin also features grading tools and feedback options, though these are generally more useful for educators than for students or researchers.

These tools can serve as your arsenal in conducting a high-quality literature review, whether you're a master's student, a doctoral researcher, or a seasoned academic.

- Plagiarism checking

- Peer review

- Grading tools

- Feedback studio

- Originality reports

Speechify TTS (Text-to-Speech) is particularly useful for graduate students and researchers who have to sift through voluminous amounts of text. Listening to the text can help you better understand the flow and transitions of your writing. It can also assist in catching errors or awkward phrasing that may not be evident while reading.

Writing a comprehensive literature review in one day is generally not advisable. While a shorter review could potentially be written within 24 hours, the quality may be compromised.

Yes, a one-week timeframe is more realistic for writing a smaller literature review, especially if you have already gathered your sources and have a clear focus.

The difficulty in writing a literature review lies in the need to read, understand, and synthesize existing research while avoiding plagiarism.

For Master's students, writing a literature review can take anywhere from two weeks to a month, given the smaller scope compared to a doctoral dissertation.

The time required to write a literature review can vary widely depending on factors such as the depth of the research topic, the number of sources, and the writer's familiarity with the subject.

Best AI Avatar Generators: Reviewed and Ranked

Celebrity Voice Generators: A How to

Cliff Weitzman

Cliff Weitzman is a dyslexia advocate and the CEO and founder of Speechify, the #1 text-to-speech app in the world, totaling over 100,000 5-star reviews and ranking first place in the App Store for the News & Magazines category. In 2017, Weitzman was named to the Forbes 30 under 30 list for his work making the internet more accessible to people with learning disabilities. Cliff Weitzman has been featured in EdSurge, Inc., PC Mag, Entrepreneur, Mashable, among other leading outlets.

Get the Reddit app

Discussions about the writing craft.

I don’t understand how to write a literature review.

Hi guy, I don’t if this forum is the right place. I struggle from adhd and can’t really understand how to write a literature review. I feel there aren’t enough examples shown to get that confidence in what I am doing. I really need advice on any open sources I could help myself with.

File(s) under embargo

Reason: Interested in publishing within the next year.

until file(s) become available

ASSESSING THE IMPACT OF STRUCTURED REVISION AFTER PEER REVIEW ON FIRST YEAR BIOLOGY LAB STUDENT SCIENTIFIC WRITING SELF-EFFICACY AND UTILITY VALUE

Scientific writing is a core competency within the undergraduate biology curriculum (AAAS, 2010), as it has wide-ranging applications in academic and professional life, alongside being a powerful tool for formative learning (Wingate, 2010). Due to its importance in critical analysis and understanding of biological concepts, developing scientific writing is necessary for success within the biological sciences disciplines (Clemmons et al., 2020). Peer review has emerged as a common pedagogical technique to address the need for scientific writing training. The expansive literature on peer review indicates its ability to engage students in critical thinking, increase writing confidence, and improve academic performance on writing assignments (Dochy et al., 1999; S. Gielen et al., 2010; van Zundert et al., 2010). Research on the usage of scaffolded curriculum within peer review has shown increased review validity from students (Cho et al., 2006; Liu & Li, 2014), and integrated plans to revise leads to increased revisions (Wu & Schunn, 2021) and the incorporation of more feedback that is correct (Jurkowski, 2018). However, despite the breadth of peer review research, the number of quasi-experimental and experimental studies assessing the benefits and perceptions of revision is small (Double et al., 2020; van Zundert et al., 2010). This study provides a detailed look at the effects of scaffolded peer review and structured revision on student perceptions of scientific writing self-efficacy and the utility value of the peer review process. After performing peer review, students were given either a supported revision worksheet, wherein students list the feedback received and if it is useful for revisions, or a general revision worksheet, where students list their planned revisions. Quantitative surveys and qualitative reflection questions were administered to gauge the scientific writing ability and the perceived usefulness of peer review and were compared between treatment groups. Little to no difference was found in how students perceived their scientific writing self-efficacy and the utility value of the peer review process. Despite the lack of differences, analysis of the themes within responses reveals alignment with the theoretical frameworks guiding this research. This study provides a rich account of the characteristics of scientific writing self-efficacy and utility value in undergraduate biology students during peer review and revision, which have implications for the future development of an effective scaffolded peer review curriculum.

Degree Type

• Master of Science
• Biological Sciences

Campus location

• West Lafayette

Advisor/Supervisor/Committee Chair

Additional committee member 2, additional committee member 3, usage metrics.

• Science, technology and engineering curriculum and pedagogy
• Other biological sciences not elsewhere classified

• Case Report
• Open access
• Published: 21 June 2024

Fever of unknown origin revealing testicular nocardiosis: a case report and literature review

• Saohoine Inthasot 1 ,
• Sophie Leemans 2 ,
• Mony Hing 3 &
• Julien Vanderhulst 1  

BMC Infectious Diseases volume  24 , Article number:  614 ( 2024 ) Cite this article

Metrics details

Nocardia is an ubiquitous soil organism. As an opportunistic pathogen, inhalation and skin inoculation are the most common routes of infection. Lungs and skin are the most frequent sites of nocardiosis. Testis is a highly unusual location for nocardiosis.

Case presentation

We report the case of an immunocompromised 75-year-old-man admitted for fever of unknown origin. He presented with skin lesions after gardening and was first suspected of Mediterranean spotted fever, but he did not respond to doxycycline. Then, physical examination revealed new left scrotal swelling that was compatible with a diagnosis of epididymo-orchitis. The patient’s condition did not improve despite empirical antibiotic treatment with the onset of necrotic scrotal abscesses requiring surgery. Nocardia brasiliensis yielded from the removed testis culture. High-dose trimethoprim-sulfamethoxazole and ceftriaxone were started. Multiple micro-abscesses were found in the brain and spinal cord on imaging studies. After 6 weeks of dual antibiotic therapy for disseminated nocardiosis, slight regression of the brain abscesses was observed. The patient was discharged after a 6-month course of antibiotics and remained relapse-free at that time of writing these lines. Trimethoprim-sulfamethoxazole alone is meant to be pursued for 6 months thereafter. We undertook a literature review on previously reported cases of genitourinary and urological nocardiosis; to date, only 36 cases have been published with predominately involvement of kidney, prostate and testis.

Conclusions

To the best of our knowledge, this is the first case of Nocardia brasiliensis simultaneously infecting skin, testis, brain and spinal cord in an immunocompromised patient. Knowledge on uncommon forms of nocardiosis remains scarce. This case report highlights the difficulty of diagnosing atypical nocardiosis and the importance of prompt bacteriological sampling in case of empirical antibiotics failure.

Peer Review reports

Members of the genus Nocardia are aerobic, Gram-positive, beaded, and partially acid-fast bacilli with the microscopic appearance of branching hyphae, belonging to the Corynebacterineae suborder. They are ubiquitous soil organisms. As an opportunistic pathogen, inhalation and skin inoculation are the most common routes of infection. Lungs and skin are the most frequent sites of nocardiosis. Testis is a highly unusual location for nocardiosis. We herein report the case of an immunocompromised patient with fever of unknown origin unmasking disseminated nocardiosis involving testis, brain and spinal cord. We have included a literature review on previous case reports of genitourinary and urological nocardiosis.

A 75-year-old man was admitted for fever of unknown origin. He had previously been diagnosed with polymyalgia rheumatica, for which a treatment with methylprednisolone 16 mg once a day (OD) was begun 4 months before admission. Methotrexate 10 mg weekly had been introduced 2 months before his admission. He had a past history of acquired amegacaryocytic thrombocytopenia that had been treated with cyclosporin more than 10 years ago.

After his two-month vacation in South of France, where he had been gardening without wearing gloves, he developed a fever above 39 °C with complaints of sore throat. Amoxicillin-clavulanic acid was started after the patient was seen in the emergency room of another hospital.

As the fever persisted, he presented to the emergency room of our institution. An atypical papular skin rash with a necrotic lesion on the back of the left hand, combined with his recent vacation location, prompted an initial suspicion of Mediterranean spotted fever (Fig.  1 ).

Skin necrotic lesion on the back of the hand

Therefore, doxycycline 100 mg BID was introduced as an empirical treatment. Antibiotics were continued for 7 days. Meanwhile, a first serologic test for Rickettsia conorii turned negative. Fever and malaise persisted for more than two weeks in total and, after a week of ineffective doxycycline, antibiotics were discontinued.

After 2 weeks of pyrexia, the patient was hospitalized in our internal medicine department. He initially complained primarily about fatigue. He had no arthralgia. Nobody close to him was sick and there was no history of animal exposure. On admission, his vital signs were as follows: body temperature 37,8 °C; pulse rate 66/min; and blood pressure 110/60 mmHg. A physical examination revealed virtual disappearance of the skin lesions and a new aortic heart murmur. First-line laboratory analyses showed an elevation of the C-reactive protein level (CRP) at 45,0 mg/L (normal value < 5,0 mg/L). Transesophageal echocardiography did not show any evidence of infective endocarditis. A chest, abdomen and brain computed tomography (CT) was unremarkable. Methotrexate was discontinued on admission.

No obvious sign of vasculitis was noted on CT brain angiography. Serologic testing for Brucella, Rickettsia conorii and R. mooseri, Coxiella burnetii, Bartonella henselae , Borrelia burgdorferi , Treponema pallidum and human immunodeficiency virus proved negative. Cytomegalovirus and Epstein-Barr virus serologies were compatible with past infection. Rheumatoid factor and antinuclear antibodies turned negative. Repeated blood cultures remained sterile even after prolonged incubation of 7 days.

After 3 weeks of unexplained intermittent pyrexia, the patient was diagnosed with fever of unknown origin. Then, he mentioned a new scrotal swelling and left epididymo-orchitis was confirmed by ultrasound. Urinalysis was normal with no pyuria. Levofloxacin 500 mg OD was started empirically. In spite of a decrease in pain, swelling and CRP level, testis induration persisted. Scrotal abscesses appeared after one week of antibiotic therapy and despite increased levofloxacin doses, they evolved to necrosis. Left orchiectomy was performed. Clindamycin 600 mg TDS and ceftriaxone 2 g OD were started empirically. The dose of methylprednisolone was progressively reduced to a nadir of 2 mg OD.

Nocardia brasiliensis yielded from the testicular biopsy culture. High dose intravenous trimethoprim-sulfamethoxazole (TMP-SMX) (20 mg TMP/kg/day) was started on the 20th day of hospitalization. Ceftriaxone was increased to 2 g BID to treat potential brain involvement. Gadolinium contrast-enhanced magnetic resonance imaging (MRI) of the brain subsequently revealed multiple micro-abscesses mostly in the nucleus nuclei, dura-mater enhancement in the spinal bulb and ventriculitis (Fig.  2 ). Spinal cord MRI showed a “ring-enhancement” in right posterolateral area of the spinal cord in D12-L1, which was consistent with a 2 mm-abscess (Fig.  3 ).

MRI of brain T1 (+ gadolinium) sequence, showing multiple micro-abscesses (hyperintensities pointed by the arrows)

MRI of spinal cord T1 (+ gadolinium) sequence, showing a 2-mm abscess with a “ring enhancement” in right posterolateral area of the spinal cord in D12-L1 (arrow)

A F-18 fluorodeoxyglucose positron emission tomography/CT was performed to assess the extent of invasive nocardiosis but was unremarkable.

Multi-susceptibility was confirmed and dual parenteral antibiotic therapy with TMP-SMX and ceftriaxone was pursued for 6 weeks.

Histopathologically, signs of inflammation were observed in the testicular biopsy, as well as filamentous branching bacilli. Direct Gram staining showed the typical gram-positive, beaded, filamentous bacilli (Fig.  4 ).

Microscopic image of a gram-stained smear of N. brasiliensis from testicular biopsy, demonstrating the typical gram-positive filamentous bacilli. Magnification, x1000

The colonies displayed also partial acid-fastness with the modified form of auramine-rhodamine stain (Fig.  5 ).

Microscopic image of auramine-rhodamine modified stained smear of N. brasiliensis from testicular biopsy. Magnification, x1000

After 72 h incubation in 5% CO 2 at 37 °C on sheep blood agar, colonies grew, appearing as chalky white cotton balls because of the presence of abundant aerial filaments (Fig.  6 ).

Colonies of N. brasiliensis grown on blood agar plate

Nocardia brasiliensis was identified by matrix-associated laser desorption ionization-time of flight mass spectrometry (MALDI-TOF Biotyper Sirius IVD version 4.2.100; Bruker Daltonics, Bremen, Germany) with a reliable score value (2.06). To confirm the germ identification, 16S rRNA gene sequencing using universal primers (27F: 5’AGAGTTTGATCMTGGCTCAG3’ and 1492R: 5’TACGGYTACCTTGTTACGACTT3’; NF1: 5’TWACACATGCAAGTCGARCG3’ and NF2: 5’CCAACATCTCACGACACGAG3’) was performed on cultured colonies. Its yielded sequence (1025 bp) had 99.90% homology with N. brasiliensis strain DSM AUSMDU00024985 (GenBank accession no.: CP046171.1) by using the NCBI database and the EZBiocloud.

The antimicrobial susceptibility testing was performed by minimum inhibitory concentration (MIC) using E-test gradient strips (BioMérieux, Marcy l’Etoile, France) and interpreted following Clinical and Laboratory Standards Institute (CLSI) M62-ED1:2018 guidelines for Nocardia (Table  1 ).

Clinical evolution was marked by a slow improvement of the patient’s general condition. Fever gradually decreased in intensity and frequency. Control brain and spinal cord MRI’s were obtained shortly before the end of the 6 weeks of parenteral bitherapy (Figs.  7 and 8 ): a slight regression of the brain micro-abscesses was observed, and they appeared to be less enhanced by gadolinium, while the spinal cord lesion remained stable.

RMI of brain T1 (+ gadolinium) sequence, performed after 6 weeks of antibiotics, showing slight regression of the abscesses

RMI of spinal cord T1(+ gadolinium) sequence, performed after 6 weeks of antibiotics, showing a stable abscess (arrow)

High dose TMP-SMX was then switched from parenteral to oral route and pursued as a monotherapy. At the time of writing these lines, the patient has just been discharged from the rehabilitation department after almost 6 months of treatment. Another control brain MRI showed further reduction of the abscesses. Clinically, the patient still has some walking impairment that requires physiotherapy, with slow but constant improvement. TMP-SMX is meant to be pursued for 6 months thereafter.

Nocardiosis most commonly affects immunocompromised patients but may occur in immunocompetent hosts [ 1 , 2 , 3 , 4 ]. Disseminated nocardiosis is defined as the involvement of at least two non-contiguous organs and/or demonstration of bloodstream infection [ 1 , 2 , 4 , 5 ]. The most frequently infected sites are the lungs, brain and skin [ 3 , 6 , 7 ]. Fever at presentation is inconstant [ 1 , 2 , 3 , 4 ]. Diagnosing nocardiosis only by skin inspection is difficult because Nocardia lesions are not specific. They may appear as papules, pustules, nodules and skin infiltration [ 1 , 5 , 6 ]. In our case, with the patient’s epidemiological context, the skin lesions were considered suspicious of a rickettsial disease at the time of presentation. Nocardia skin inoculation while gardening seems to be the pathway to infection in our patient.

Nocardia infects the central nervous system (CNS) in one-third of all cases and it usually manifests as brain abscess while meningitis is rare [ 5 , 8 ]. Multiple abscesses are seen in 50–80% of the patients [ 6 ]. It has been very rarely reported with N. brasiliensis . Patients sometimes present with headache, nausea, vomiting, seizure or alteration in consciousness [ 1 , 7 ]. CNS invasion may nevertheless be asymptomatic and missing the diagnosis of CNS nocardiosis may cause treatment delay and failure. It has been suggested to perform systematic brain MRI to all patients with a diagnosis of nocardiosis [ 5 , 6 ]. In our case, lumbar puncture was discussed but not performed because of thrombocytopenia (less than 50 000 platelets/µL), reactions to previous platelet transfusions and clinical improvement with antibiotics. Besides, Nocardia is only exceptionally identified in cerebral spinal fluid culture [ 8 ]. Although invasive nocardiosis is generally considered to occur through hematogenous dissemination, identifying Nocardia species on blood culture is very uncommon [ 2 , 5 ].

Infections of the urinary and urological systems are usually caused by species of the family Enterobacteriaceae ; Nocardia infection is extremely rare [ 4 , 8 , 9 ]. We searched PubMed for English-language reports of genitourinary and urological nocardiosis from 1970 to 2022. We found 36 complete cases previously published in the literature [ 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 ] (Table  2 ). All except four cases (nr 17, 27, 29 and 31) involved immunocompromised hosts, mostly transplant patients and patients on corticosteroids. Kidneys, prostate and testes were the most commonly infected organs. N. asteroides was the most frequent pathogen. Implication of N. brasiliensis causing urological and genitourinary infection seems rarer but all cases reported skin involvement. It has been described that this strain is more prevalent in cutaneous infections [ 1 , 9 ]. In our case, N. brasiliensis is thought to have spread hematogenously from the skin to testicular, cerebral and spinal cord sites.

The diagnosis of nocardiosis requires the identification of Nocardia in a bacteriological sample. Nocardia can be isolated by culture from different samples such as sputum, bronchoalveolar lavage fluid, abscess fluid and blood [ 4 , 7 ]. Because of the slow-growing nature of Nocardia , isolates can take up to 2 weeks to grow on routine culture media used in clinical laboratories, making them difficult to identify [ 7 ]. Nevertheless, identification of Nocardia species is important because antimicrobial susceptibility varies among species [ 1 , 2 , 4 , 5 , 6 , 7 ].

Optimal management for nocardiosis has not been established because of the lack of comparative controlled studies, due to the rarity of the cases. TMP-SMX remains the first-choice agent due to good responses as observed since 1950s and because of its good penetration in the CNS [ 1 , 5 , 6 ]. The main adverse reactions to high-dose TMP-SMX therapy are myelosuppression, hepatotoxicity, renal insufficiency and allergic reaction. Linezolid is a good alternative for disseminated and CNS nocardiosis, but its toxicity includes a high risk of myelosuppression and peripheral neuropathy [ 1 ]. Initial multidrug therapy is recommended for most forms of nocardiosis (except limited skin infection). Therapeutic changes should be based on initial therapy, susceptibility results and individual specificities. Treatment duration is generally extended to minimize the risk of disease relapse [ 6 ]. Nocardia infections may recur because of the slow replication of the pathogen and its intracellular presence [ 7 ]. Immunodeficient hosts and/or patients with CNS nocardiosis should receive at least 12 months of antimicrobial therapy (initially intravenous therapy for 4–6 weeks followed by oral agent for 6–12 months) [ 1 , 6 , 38 ]. Neurosurgical drainage should be considered in case of large brain abscess not responding to antimicrobial therapy. Patients with surgical and antibiotics therapy had lower mortality [ 6 ].

To the best of our knowledge, this is the first case of N. brasiliensis simultaneously infecting skin, testis, brain and spinal cord in an immunocompromised patient. Our case highlights the difficulty of nocardiosis diagnosis due to complex clinical manifestations. Even though pulmonary, neurological and dermatological involvement are commonly described, the two latter forms may have, as in our patient, tricky clinical presentations and the disease may spread to virtually any organ such as testis.

Knowledge on atypical forms of nocardiosis remains scarce. With our case, we aim to both raise clinician’s awareness and add our experience to the handful of cases described in the literature.

Data availability

No datasets were generated or analysed during the current study.

Abbreviations

Central Nervous System

C-reactive Protein

Computed Tomography

Minimum Inhibitory Concentration

Magnetic Resonance Imaging

Trimethoprim-sulfamethoxazole

Wilson JW. Nocardiosis: updates and clinical overview. Mayo Clin Proc. 2012;87(4):403–7.

Williams E, Jenney AW, Spelman DW. Nocardia bacteremia: a single-center retrospective review and a systematic review of the literature. Int J Infect Dis. 2020;92:197–207.

Article   CAS   PubMed   Google Scholar  

Steinbrink J, Leavens J, Kauffman CA, Miceli MH. Manifestations and outcomes of Nocardia infections: comparison of immunocompromised and nonimmunocompromised adult patients. Medicine. 2018;97(40):e12436.

Article   PubMed   PubMed Central   Google Scholar  

Haussaire D, Fournier PE, Djiguiba K, Moal V, Legris T, Purgus R, et al. Nocardiosis in the south of France over a 10-years period, 2004–2014. Int J Infect Dis. 2017;57:13–20.

Article   PubMed   Google Scholar  

Lerner P, Nocardiosis. Clin Infect Dis. 1996;22(6):891–903.

Margalit I, Lebeaux D, Tishler O, Goldberg E, Bishara J, Yahav D, et al. How do I manage nocardiosis? Clin Microbiol Infect. 2021;27(4):550–8.

Duggal SD, Chugh TD, Nocardiosis. A neglected disease. Med Princ Pract. 2020;29(6):514–23.

Meena DS, Kumar D, Bohra GK, Midha N, Garg MK. Clinical characteristics and treatment outcome of central nervous system nocardiosis: a systematic review of reported cases. Med Princ Pract. 2022;31(4):333–41.

Sakamaki I, Ueno A, Kawasuji H, Miyajima Y, Kawago K, Hishikawa Y, et al. Prostate abscess caused by Nocardia Farcina . IDCases. 2019;18:e00640.

Mahvi TA. Disseminated nocardiosis caused by Nocardia brasiliensis : first case report in the United States. Arch Dermatol. 1964;89(3):426–31.

Young LS, Armstrong D, Blevins A. Nocardia asteroides infection complicating neoplastic disease. Am J Med. 1971;50(3):356–67.

Diamond RD, Bennett JE. Disseminated Nocardia brasiliensis infection. Arch Intern Med. 1973;131(5):735–6.

Geelhoed GW, Myers GH. Nocardiosis of the testis. J Urol. 1974;111(6):791–3.

Strong D, Hodges C. Disseminated nocardiosis presenting as testicular abscess. Urology. 1976;7(1):57–9.

Wheeler JS, Culkin DJ, O’Connell J, Winters G. Nocardia epididymo-orchitis in an immunosuppressed patient. J Urol. 1986;136(6):1314–5.

Parmentier L, Salmon-Ceron D, Boiron P, Paul G, Guez T, Dupont B, et al. Pneumopathy and kidney abscess due to Nocardia farcinica in an HIV-infected patient. AIDS. 1992;6(8):891–3.

Shohaib S. Nocardial psoas and perinephric abscess in a renal transplant treated by surgery and antibiotics. Nephrol Dial Transpl. 1994;9(8):1209–10.

Article   CAS   Google Scholar  

López E, Ferrero M, Lumbreras C, Gimeno C, González-Pinto I, Palengue E. A case of testicular nocardiosis and literature review. Eur J Clin Microbiol Infect Dis. 1994;13(4):310–3.

Diego Miralles G. Disseminated Nocardia farcinica infection in an AIDS patient. Eur J Clin Microbiol Infect Dis. 1994;13(6):497–500.

Article   Google Scholar  

Salahuddin F, Sen P, Chechko S. Urinary tract infection with an unusual pathogen Nocardia asteroides . J Urol. 1996;155(2):654–5.

Frangié C, Morel D, Sassoust G, Pariente JL, Grenier N, Lacut JY, et al. A rare infection in a renal transplant recipient. Nephrol Dial Transpl. 2001;16(6):1285–7.

Benes J, Viechova J, Picha D, Horova B, Zatloukal P. Disseminated Nocardia asteroides infection in an immunocompetent woman following an arm injury. Infection. 2003;31(2):112–4.

Qu L, Strollo DC, Bond G, Kusne S. Nocardia prostatitis in a small intestine transplant recipient. Transpl Infect Dis. 2003;5(2):94–7.

Routh JC, Lischer GH, Leibovich BC. Epididymo-orchitis and testicular abscess due to Nocardia asteroides complex. Urology. 2005;65(3):591.

Severo CB, Oliveira FDM, Cunha L, Cantarelli V, Severo LC. Nocardia farcinica : diagnosis by thyroid abscess culture. Rev Inst Med Trop Sao Paulo. 2005;47(6):355–8.

Kepkep K, TunCay YA, YIgItbasI R. Nocardial tubo-ovarian abscess in a pregnant woman: a rare case report. Aust N Z J Obstet Gynaecol. 2006;46(4):363–5.

Gallo A, Bettoni G, Trezzi G, Lalinga V, Frigerio L. Primary vulvar nocardiosis. Obstet Gynecol. 2006;108(3):728–30.

Dehghani M, Davarpanah MA. Epididymo-orchitis and central nervous system nocardiosis in a bone marrow transplant recipient for acute lymphoblastic leukemia. Exp Clin Transpl. 2009;7(4):264–6.

Google Scholar  

Tanioka K, Tabu H, Uemura K, Matsumoto R, Takahashi R, Nagao M, et al. Disseminated Nocardia farcinica infection in a patient with myasthenia gravis successfully treated by linezolid: a case report and literature review. J Infect Chemoter. 2012;18(3):390–4.

De Montmollin E, Corcos O, Noussair L, Leflon-Guibout V, Belmatoug N, Joly F, et al. Retroperitoneal abscesses due to Nocardia farcinica : report of two cases in patients with malnutrition. Infection. 2012;40(1):93–6.

Yamaguchi H, Sekimoto E, Shirakami A, Shibata H, Ozaki S, Shigekiyo T, et al. Testicular nocardiosis accompanied by cutaneous lesions in an immunocompetent man. Intern Med. 2013;52(1):129–33.

Poisnel E, Roseau JB, Landais C, Rodriguez-Nava V, Bussy E, Gaillard T. Nocardia veterana : disseminated infection with urinary tract infection. Braz J Infect Dis. 2015;19(2):216–9.

Eren E, Ulu-Kilic A, Atalay A, Demiraslan H, Parkan O, Koc N. Report of an immunocompetent case with disseminated infection due to Nocardia otitidiscaviarum : identification by 16S rRNA gene sequencing. Infez Med. 2016;24(1):71–6.

PubMed   Google Scholar  

Scorey H, Daniel S. Nocardia farcinica bacteraemia presenting as a prostate abscess. IDCases. 2016;5:24–6.

Bonifaz A, Espinosa-Díaz S, Argáez J, Hernández-Castro R, Xicohtencatl-Cortes J, Tirado-Sánchez A. Actinomycetoma due to Nocardia brasiliensis with extension to the ovaries. Eur J Obstet Gynecol Reprod Biol. 2017;211:224–5.

Biswas Roy S, Ross MD, Patil PD, Trepeta R, Bremner RM, Panchabhai TS. Primary Nocardia infection causing a fluorodeoxyglucose-avid right renal Mass in a redo lung transplant recipient. Case Rep Transpl. 2018;2018:1–5.

Marques C, Ribeiro M, Bonccoraglio MT, Braga J, Pereira AF, Ogando A. Disseminated nocardiosis: the complexity of the diagnosis. J Med Cases. 2021;12(5):205–8.

Pan L, Wang XH, Meng FQ, Su XM, Li Y, Xu MT, et al. Membranous nephropathy complicated with disseminated Nocardia farcinica infection: a case report and literature review. Infect Drug Resist. 2021;14:4157–66.

Shen TA, Hsu YH, Ding DC. Xanthogranulomatous inflammation caused by K. pneumonia and nocardiosis mimicking a uterine tumor and invading the ureter and colon: a case report and review of the literature. Taiwan J Obstet Gynecol. 2022;61(5):889–95.

Torres OH, Domingo P, Pericas R, Boiron P, Montiel JA, Vázquez G. Infection caused by Nocardia farcinica : case report and review. Eur J Clin Microbiol Infect Dis. 2000;19(3):205–12.

Van Luin A, Manson WL, Van Der Molen L, Van Der Heide JJH, Van Son WJ. An intrarenal abscess as presenting symptom of an infection with Nocardia farcinica in a patient after renal transplantation. Transpl Infect Dis. 2008;10(3):214–7.

Download references

Acknowledgements

Not applicable.

Author information

Authors and affiliations.

Department of Internal Medicine, CHU Brugmann, Université Libre de Bruxelles, Brussels, Belgium

Saohoine Inthasot & Julien Vanderhulst

Department of Infectious Diseases, CHU Brugmann, Université Libre de Bruxelles, Brussels, Belgium

Sophie Leemans

Department of Microbiology, Laboratoire Hospitalier Universitaire de Bruxelles-Universitair Laboratorium Brussel (LHUB-ULB), Université Libre de Bruxelles, Brussels, Belgium

You can also search for this author in PubMed   Google Scholar

Contributions

S.I. performed in-hospital clinical follow-up, wrote the original article, performed literature review and included the comments and corrections of the other authors; S.L. guided antibiotic treatment according to literature, provided clinical follow-up and edited the manuscript; MH performed microbiological analysis and edited the manuscript; JV supervised in-hospital clinical follow-up and edited the manuscript. All authors have read and approved the final manuscript.

Corresponding author

Correspondence to Saohoine Inthasot .

Ethics declarations

Ethics approval and consent to participate, consent for publication.

Written informed consent was obtained from the patient for the publication of this case report and any accompanying images.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Inthasot, S., Leemans, S., Hing, M. et al. Fever of unknown origin revealing testicular nocardiosis: a case report and literature review. BMC Infect Dis 24 , 614 (2024). https://doi.org/10.1186/s12879-024-09521-8

Download citation

Received : 09 April 2024

Accepted : 17 June 2024

Published : 21 June 2024

DOI : https://doi.org/10.1186/s12879-024-09521-8

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Epididymo-orchitis
• Scrotal abscess
• Testicular nocardiosis
• Brain abscess
• Disseminated nocardiosis
• Fever of unknown origin

BMC Infectious Diseases

ISSN: 1471-2334

• General enquiries: [email protected]